Name: _________________________
Biology 351- Homework Assignment #5 (10 points)
This assignment is due on Tuesday February 20th in lab by 11:21AM. Give yourself enough time to print out your assignment in case you have printer problems. I will not accept electronic copies. Hardcopies only, and late assignments are not accepted in the biology department.
- During transcriptional initiation RNA polymerase holoenzyme recognizes the consensus sequences within the promoter of coli. What part of the RNA polymerase holoenzyme recognizes the consensus sequence?
- A single strand of bacterial DNA contains the base sequence
-35 -10 +1
5’ CGTGTATTGACACTGGTGAGCCACTATCGTATATTCCCTAAGTGAGTATTGG 3’
- What is the complementary sequence? Draw or type this sequence just below and indicate its polarity (directionality) in order to create a double-stranded DNA sequence.
- Under the double-stranded DNA sequence, draw or type the mRNA sequence that will be translated, and indicate its polarity.
- Which strand of the DNA serves as the coding strand, and which serves as the template strand, for the synthesis of the RNA transcript for this hypothetical gene fragment.
- If a stop codon is not included in the mRNA molecule, how would this affect the following:
- translocation on the mRNA by polyribosomes
- concentration of this specific polypeptide in the cell
- How many different types of tRNA molecules exist in the cell? For what purpose (hint: why are there 20 different tRNA molecules)?
Please follow and like us:

